Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A 3D photocrosslinked microarray was used to immobilize proguanil, and then T24 lysates were distributed on the surface of the microarray. The captured target proteins by proguanil on the microarray surface were detected by SPRi and identified by LC-MS. B MOE molecular docking (using MOE14.0 software) was used to predict the binding site of proguanil and EGFR (PDB ID − 4HJO). C T24 were plated in 6-well plates (3.0 × 10 5 /well). When the cell density reaches 70–80%, cells were starved for 12 h and then treated with proguanil for 6 h, and the expression of p-EGFR and EGFR was detected by WB. D T24 were plated in 6-well plates (3.0 × 10 5 /well). When the cell density reaches 70–80%, cells were starved for 12 h and then treated with proguanil for 6 h, and the expression level of EGFR mRNA was detected by RT-PCR. E T24 were plated on glass disks in 12-well plates (2.0 × 10 4 /well). After 24 h, T24 cells were starved for 12 h and then treated with proguanil, and the changes of EGFR were detected by immunofluorescence. Data are representative of three independent experiments. Error bars represent means ± SD from triplicate experiments. Vehicle control means the concentration of DMSO lower than 0.3% (* P < 0.05, ** P < 0.01, *** P < 0.001, ns not significant).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Microarray, Liquid Chromatography with Mass Spectroscopy, Software, Binding Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence, Control, Concentration Assay

Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A The expression levels of EGFR in different types of bladder cancer and adjacent tissues were detected by WB. B The TCGA database was used to analyze the correlation between EGFR expression and poor prognosis in bladder cancer patients. C , D Cells were plated in 6-well plates (3.0 × 10 5 /well) and lysed to collect protein or RNA when density reached 80–90%, the expression of EGFR and mRNA in 4 BC cells were analyzed by WB and RT-PCR. E Cells were plated in 96-well plates (6.0 × 10 3 /well), The proliferation of T24 and J82 cells was detected at specified times by MTT assay. EGFR stable knockdown ( F ) and overexpressed ( G ) cell lines were constructed by lentiviral vector plasmid as described in “Materials and methods”, then cells were plated in 6-well plates (3.0 × 10 5 /well) and lysed to collect protein when density reached 80–90%. The expression of EGFR was detected by WB. H , I Cells were plated in 96-well plates (6.0 × 10 3 /well), the proliferation of cell lines were detected at specified times by MTT assay. Data are representative of three independent experiments. Error bars represent means ± SD from triplicate experiments. Vehicle control means the concentration of DMSO lower than 0.3% (* P < 0.05, ** P < 0.01, *** P < 0.001).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, MTT Assay, Knockdown, Construct, Plasmid Preparation, Control, Concentration Assay

Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A – C The inhibitory effects of proguanil on proliferation and migration of T24 and J82 cell lines were compared by MTT, colony formation and transwell assay. D – F The inhibitory effects of proguanil on proliferation and migration of shCtrl, shEGFR-1 and shEGFR-2 cell lines were compared by MTT, colony formation and transwell assay. G – I The inhibitory effects of proguanil on proliferation and migration of OC-J82 and OE-J82 were compared by MTT, colony formation and transwell assay. See “Materials and methods” for more experimental details. Data are representative of three independent experiments. Error bars represent means ± SD from triplicate experiments. Vehicle control means the concentration of DMSO lower than 0.3% (* P < 0.05, ** P < 0.01, *** P < 0.001).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Migration, Transwell Assay, Control, Concentration Assay

Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A , B T24 were plated in 6-well plates (2.0 × 10 5 /well) and transfected with corresponding siRNA as described in “Materials and methods”. When the cell density reaches 70–80%, cells were starved for 12 h and then treated with proguanil for 6 h. The effect of proguanil on the expression of EGFR was detected by WB. C After si Clathrin or si Caveolin-1 as described in “Materials and methods”, T24 were plated on glass disks in 12-well plates (2.0 × 10 4 /well), starved for 12 h and then treated with proguanil, and the changes of EGFR were detected by immunofluorescence. D When the density of T24 reaches 70–80% in 75 cm 2 vented culture flasks, cells starved for 12 h and then treated with proguanil. Then protein lysates were immunoprecipitated with EGFR antibody. The immunoprecipitate were tested by WB with antibodies to EGFR, Clathrin and Caveolin-1. E Cells were transfected with corresponding siRNA as described in “Materials and methods” and then plated in 96-well plates (6.0 × 10 3 /well), the bioactivity of proguanil after si Clathrin or si Caveolin-1 was detected by MTT assay. Data are representative of three independent experiments. Error bars represent means ± SD from triplicate experiments. Vehicle control means the concentration of DMSO lower than 0.3% (* P < 0.05, ** P < 0.01, *** P < 0.001, ns not significant).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Transfection, Expressing, Immunofluorescence, Immunoprecipitation, MTT Assay, Control, Concentration Assay

Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A When the density of T24 reaches 70–80% in 75 cm 2 vented culture flasks, cells starved for 12 h and then treated with proguanil. Then protein lysates were immunoprecipitated with EGFR antibody. The immunoprecipitates were tested by WB with antibodies to EGFR, c-Cbl and Ub. B When the density of T24 reaches 70–80% in 75 cm 2 vented culture flasks, cells starved for 12 h and then treated with proguanil. Then protein lysates were immunoprecipitated with Ub antibody. The immunoprecipitates were tested by WB with antibodies to EGFR, c-Cbl and Cav-1. C T24 were plated in 6-well plates (2.0 × 10 5 /well) and transfected with corresponding siRNA as described in “Materials and methods”. When the cell density reaches 70–80%, cells were starved for 12 h and then treated with proguanil for 6 h. The effect of proguanil on the expression of EGFR and c-Cbl were detected by WB. D After si c-Cbl as described in “Materials and methods”, T24 were plated on glass disks in 12-well plates (2.0 × 10 4 /well), starved for 12 h and then treated with proguanil for 6 h. The effects of proguanil on EGFR endocytosis and expression were detected by immunofluorescence. E Cells were transfected with corresponding siRNA as described in “Materials and methods” and then plated in 96-well plates (6.0 × 10 3 /well). The bioactivity of proguanil on cells after si c-Cbl was detected by MTT assay. Data are representative of three independent experiments. Error bars represent means ± SD from triplicate experiments. Vehicle control means the concentration of DMSO lower than 0.3% (* P < 0.05, ** P < 0.01, *** P < 0.001, ns not significant).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Immunoprecipitation, Transfection, Expressing, Immunofluorescence, MTT Assay, Control, Concentration Assay

Journal: Cell Death & Disease

Article Title: Inhibitory role of proguanil on the growth of bladder cancer via enhancing EGFR degradation and inhibiting its downstream signaling pathway to induce autophagy

doi: 10.1038/s41419-022-04937-z

Figure Lengend Snippet: A 10 7 T24 and shEGFR-2 T24 cell suspension were injected into the right and left axilla of mice in group 2 and group 3. When the tumor volume reached 70–100 mm 3 , mice in group 3 were treated with proguanil. After treated 14 days, tumors were removed and photographed. B The tumor volume of each mouse was measured every two days, and the mean volume of each group tumor was calculated to create the figure. C Statistical analysis of tumor weight. D Ki-67 was used to analyze the proliferation of xenograft tumor. E The expression of EGFR in tumor tissues was detected by immunohistochemistry. F Changes of each group mice weight. G HE staining of liver and kidney organs of each group mice. All in vitro experiments are representative of three independent experiments. Error bars represent means ± SD. Vehicle control(2% PEG-400 + 2% Tween-80 + 96% PBS). (* P < 0.05, ** P < 0.01, *** P < 0.001, ns not significant).

Article Snippet: The EGFR knockdown lentiviral vectors shCtrl, shEGFR-1, shEGFR-2, shEGFR-3 (Supplementary Table ), and EGFR overexpression lentiviral vectors overexpression Ctrl (OC), overexpression EGFR (OE) were constructed by GeneChem Co. Ltd. (Shanghai, China).

Techniques: Suspension, Injection, Expressing, Immunohistochemistry, Staining, In Vitro, Control

Journal: iScience

Article Title: Olfactory receptor 5B21 drives breast cancer metastasis

doi: 10.1016/j.isci.2021.103519

Figure Lengend Snippet: OR5B21 regulates breast cancer invasion/migration (A and B) 231BR, 231LM, and 231BO expressing either shCTRL or shOR5B21 were plated as a monolayer, scratched, and analyzed by bright-field microscopy at different time points. Representative images (A) and relative quantification of migratory cells (B) are shown (n = 4). (C and D) 231P cells overexpressing OR5B21 (or control cells) or 231BR, 231LM, 231BO cells transduced with shOR5B21 or scrambled shRNA (shCTRL) were plated on Matrigel-coated Transwell chambers. Forty-eight hours later, cells that migrated to the bottom well were stained with crystal violet and counted (n = 4). (E and F) 231P and MCF7 control cells or overexpressing OR5B21 were plated, scratched, and analyzed at different time points (n = 3). Data presented as mean ± SEM; ∗p < 0.05, ∗∗p < 0.01 by unpaired Student's t test. Scale bar, 150 μm (A and E), 100 μm (C).

Article Snippet: Lentiviral vectors expressing shRNA for OR5B21 and shCTRL were purchased from Sigma (SIGMA TRCN0000203498; sequence: CCGGCTATGGCACAATCATCTTCATCTCGA GATGAAGATGATTGTGCCATAGTTTTTTG).

Techniques: Migration, Expressing, Microscopy, Transduction, shRNA, Staining

Journal: iScience

Article Title: Olfactory receptor 5B21 drives breast cancer metastasis

doi: 10.1016/j.isci.2021.103519

Figure Lengend Snippet: OR5B21 knockdown inhibits breast cancer metastasis 231BR cells expressing Fluc and either shCTRL or shOR5B21 were injected intracardially into athymic mice, and metastasis was monitored over time by bioluminescence imaging. (A) Mouse images at days 7, 14, and 21 post cell injections. (B) Overall whole-body bioluminescence signals at different time points; data presented as mean ± SEM; ∗∗p < 0.01 (n = 10 mice/group), unpaired Student’s t test. (C) Brain, lung, and bone metastasis incidence rate for each group over time. (D) Kaplan-Meir survival curves for each group, p = 0.0024 Log rank (Mantel-cox) test (n = 10 mice/group).

Article Snippet: Lentiviral vectors expressing shRNA for OR5B21 and shCTRL were purchased from Sigma (SIGMA TRCN0000203498; sequence: CCGGCTATGGCACAATCATCTTCATCTCGA GATGAAGATGATTGTGCCATAGTTTTTTG).

Techniques: Expressing, Injection, Imaging

Journal: iScience

Article Title: Olfactory receptor 5B21 drives breast cancer metastasis

doi: 10.1016/j.isci.2021.103519

Figure Lengend Snippet: OR5B21 regulates invasion/migration through STAT3/NF-κB/CEBPβ signaling pathway (A) Relative mRNA levels of MMP1, MMP2, MMP9, SNAIL, α-SMA, N-CAD (normalized to β-Actin) in 231BR, 231LM, and 231BO expressing shCTRL or shOR5B21 (n = 7). (B) 231BR, 231LM, and 231BO cells expressing shCTRL or shOR5B21 were analyzed by western blotting for p-STAT3, STAT3, p-P65, P65, C/EBP-β, and β-Actin loading control. Representative blots from three independent experiments are shown, while bar graphs represent relative quantification of each target, normalized to β-Actin. Data presented as mean ± SEM (n = 3); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 by unpaired Student's t test.

Article Snippet: Lentiviral vectors expressing shRNA for OR5B21 and shCTRL were purchased from Sigma (SIGMA TRCN0000203498; sequence: CCGGCTATGGCACAATCATCTTCATCTCGA GATGAAGATGATTGTGCCATAGTTTTTTG).

Techniques: Migration, Expressing, Western Blot